On Mon, Oct 2, 2017 at 12:00 PM, Seungin Lyu ***@***.***> wrote: ***@***.**** commented on this pull request. It looks good overall, but you forgot to push your code for part2! ------------------------------ In gene_finder.py <#4 (comment)>: > @@ -2,7 +2,7 @@ """ YOUR HEADER COMMENT HERE For the upcoming mini projects, please add your name and a short description of the project. ------------------------------ In gene_finder.py <#4 (comment)>: > @@ -21,7 +21,10 @@ def shuffle_string(s): def get_complement(nucleotide): - """ Returns the complementary nucleotide + """ Checks for each letter and returns the complement + (might not be the most effiicent way) and returns + 'This is not a nucleotide' if any other letters are implented + Returns the complementary nucleotide Nice! Adding appropriate docstrings is always helpful. ------------------------------ In gene_finder.py <#4 (comment)>: > @@ -30,42 +33,89 @@ def get_complement(nucleotide): >>> get_complement('C') 'G' """ - # TODO: implement this - pass + if nucleotide == 'A': + return 'T' + elif nucleotide == 'T': + return 'A' + elif nucleotide == 'C': + return 'G' + elif nucleotide == 'G': + return 'C' + else: + return 'This is not a nucleotide' Another way to hand errors 👍 raise ValueError(nucleotide, " is not a nucleotide") ------------------------------ In gene_finder.py <#4 (comment)>: > + else: + return newstr + return newstr + +# V1 +# def find_all_ORFs_oneframe(dna): +# newstr1 = [] +# newstr1.append(rest_of_ORF(dna)) +# stop_codon = ['TAG','TAA','TGA'] +# index = 0 +# #newstr1 adds the first chunk to the list +# while dna[index:index+3] not in stop_codon: +# index = index + 3 +# newstr1.append(dna[index+3:]) +# #checks to find + # return newstr1 remove comments when submitting your final code. ------------------------------ In gene_finder.py <#4 (comment)>: > @@ -78,28 +128,52 @@ def find_all_ORFs_oneframe(dna): returns: a list of non-nested ORFs >>> find_all_ORFs_oneframe("ATGCATGAATGTAGATAGATGTGCCC") ['ATGCATGAATGTAGA', 'ATGTGCCC'] + >>> find_all_ORFs_oneframe("TTTATGCCCTAGATAATGTTTTAGATGCCCTAG") Nice! Always add more custom test cases to verify your function. ------------------------------ In gene_finder.py <#4 (comment)>: > """ - # TODO: implement this - pass + #print(find_all_ORFs_oneframe("ATGCATGAATGTAGATAGATGTGCCC")) + #print(find_all_ORFs_oneframe('AAAAAAAATAGAAA')) + #print(find_all_ORFs_oneframe('AAAATTTTTTAATTTTTTATTATA')) again, remove comments for the final code ------------------------------ In gene_finder.py <#4 (comment)>: > +# 'MR' +# >>> coding_strand_to_AA("ATGCCCGCTTT") +# 'MPA' +# """ +# # TODO: implement this +# pass +# +# +# def gene_finder(dna): +# """ Returns the amino acid sequences that are likely coded by the specified dna +# +# dna: a DNA sequence +# returns: a list of all amino acid sequences coded by the sequence dna. +# """ +# # TODO: implement this +# pass Looks like you forgot to push your code for part2. can you push those changes as well? — You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub <#4 (review)>, or mute the thread <https://github.com/notifications/unsubscribe-auth/AeO8pnq1T1XY6hDWbaGUKkWD_IXBFq7Rks5soQi5gaJpZM4PiAsE> .